import java.applet.*;
import java.awt.*;
import java.awt.event.*;

public class TestApplet extends Applet
  implements MouseListener, MouseMotionListener {

  int width, height;
  int x, y;    // the coordinates of the upper-left corner of the box
  int mx, my;  // the most recently recorded mouse coordinates
  boolean isMouseDraggingBox = false;
  String sequence = "ACTGATCGAAAATTTTCCCCGGGG";

  public void init() {
	width = getSize().width;
	height = getSize().height;
	setBackground( Color.black );

	x = width/2 - 20;
	y = height/2 - 20;

	//displaySequence( sequence );
	addMouseListener( this );
	addMouseMotionListener( this );
  }

  public void mouseEntered( MouseEvent e ) { }
  public void mouseExited( MouseEvent e ) { }
  public void mouseClicked( MouseEvent e ) { }
  public void mousePressed( MouseEvent e ) {
	mx = e.getX();
	my = e.getY();
	if ( x < mx && mx < x+40 && y < my && my < y+40 ) {
	  isMouseDraggingBox = true;
	}
	e.consume();
  }
  public void mouseReleased( MouseEvent e ) {
	isMouseDraggingBox = false;
	e.consume();
  }
  public void mouseMoved( MouseEvent e ) { }
  public void mouseDragged( MouseEvent e ) {
	if ( isMouseDraggingBox ) {
	  // get the latest mouse position
	  int new_mx = e.getX();
	  int new_my = e.getY();

	  // displace the box by the distance the mouse moved since the last event
	  // Note that "x += ...;" is just shorthand for "x = x + ...;"
	  x += new_mx - mx;
	  y += new_my - my;

	  // update our data
	  mx = new_mx;
	  my = new_my;

	  repaint();
	  e.consume();
	}
  }

  public void paint( Graphics g ) {
	g.setColor( Color.gray );
	g.fillRect( x, y, 40, 40 );
  }

}